 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circRNA_ 100192 | |||
| Gene | ST3GAL3 | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Diabetic Retinopathy | ICD-10 | Diabetic retinopathy (H36.0*) |
| DBLink | Link to database | PMID | 28817829 |
| Experimental Method | |||
| Sample Type | Serum sample | Comparison | Fifty-five individuals, consisting of 19 T2DR patients (T2DM patients with proliferative DR), 15 T2DM patients without DR (T2DM), and 21 age-matched control subjects (controls) |
| Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
| Primers (Experimented) | Forward GAATTAGCCACCAAGTACGCA ReverseTGGGATGCAGGCATCAGTA | Statistics | Fold Change : Upregulated,2.169,2.649 pvalue : p=0.050 |
| Citation | |||
| Gu, Y, Ke, G, Wang, L, Zhou, E, Zhu, K, Wei, Y (2017). Altered Expression Profile of Circular RNAs in the Serum of Patients with Diabetic Retinopathy Revealed by Microarray. Ophthalmic Res., 58, 3:176-184. | |||